Top » Catalog » SNPs » A16335

$19.00

A16335
[A16335]

A16335
hg38 Position: ChrY:8068280..8068288
Ancestral: del
Derived: ins
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397
Forward Primer: A16335_F TGTCATATCACTGGGCCAAC
Reverse Primer: A16335_R TGGCACCACGTCTATGGTAG
Reviews

Customers who bought this product also purchased
A17692
A17692
A16331
A16331
A16155
A16155
A16154
A16154
A16334
A16334
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies