Top » Catalog » SNPs » Z1825

$19.00

Z1825
[Z1825]

Z1825
hg38 Position: ChrY:4419831..4419831
Ancestral: C
Derived: T
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Downstream of M102. upstream of M241
Forward Primer: Z1825v3_F CACACAGCTGGGTACTCCTG
Reverse Primer: Z1825v3_R CATTGGTTATTTTAGTTATCCATTCAC
Reviews

Customers who bought this product also purchased
PF5197
PF5197
M205
M205
Z2454
Z2454
L26
L26
FT190665
FT190665
CTS2582
CTS2582
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies