Top » Catalog » SNPs » A4987

$18.00

A4987
[A4987]

A4987
hg38 Position: ChrY:20893023..20893023
Ancestral: G
Derived: A
Reference: YSEQ (2015)
ISOGG Haplogroup: A00b
Comments: .
Forward Primer: A4987_F GCTTATCATGCCCTAAAAATGC
Reverse Primer: A4987_R AAGGACCCAGGCAGAATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies