Top » Catalog » SNPs » Z24311

$18.00

Z24311
[Z24311]

Z24311
HG19 Position: ChrY:8424458..8424458
Ancestral: A
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1b1b
Comments: under CTS9737
Forward Primer: Z24311_F CAACTTTGTGCTGTATTCCTGTG
Reverse Primer: Z24311_R CCTGTGCTGGAGCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies