Top » Catalog » SNPs » A8039

$18.00

A8039
[A8039]

A8039
HG19 Position: ChrY:9858049..9858049
Ancestral: C
Derived: T
Reference: Sergey Malyshev (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L151
Forward Primer: A8039_F GGGAATTAATGTGGGTGTGG
Reverse Primer: A8039_R GCTCAGGCAGGAGAATCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies