Top » Catalog » SNPs » A16536

$18.00

A16536
[A16536]

A16536
HG19 Position: ChrY:22044854..22044854
Ancestral: C
Derived: T
Reference: FGC20747 Administrators (2017)
ISOGG Haplogroup: R1b
Comments: Below A14368
Forward Primer: A16536_F TAAAATTTGCGTGGGGACAC
Reverse Primer: A16536_R TAGGCCCTGAAAATGGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies