Top » Catalog » SNPs » A612

$19.00

A612
[A612]

A612
hg38 Position: ChrY:8587607..8587607
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19604. downstream of CTS6889 / CTS11824
Forward Primer: A612_F ATGACTGGGCAGCTGTATTTC
Reverse Primer: A612_R AGTCACAACAATATAACCACGACAC
Reviews

Customers who bought this product also purchased
A624
A624
A623
A623
A622
A622
A628
A628
A611
A611
A627
A627
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies