Top » Catalog » SNPs » CTS668

$18.00

CTS668
[CTS668]

CTS668
hg38 Position: ChrY:7066423..7066423
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3d
Comments: Extracted from 1000 genomes data. Not qualified. Below M4670
Forward Primer: CTS668_F TGCAGTGTTTCCACTGTTCC
Reverse Primer: CTS668_R GCTGAGACAGGCAGATCACC
Reviews

Customers who bought this product also purchased
CTS3274
CTS3274
Z834
Z834
Z1645
Z1645
M172
M172
FGC35964
FGC35964
M184
M184
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies