Top » Catalog » SNPs » CTS194

$18.00

CTS194
[CTS194]

CTS194
hg38 Position: ChrY:2932039..2932039
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1b1a1a2a1
Comments: Downstream CTS10323 > CTS10414
Forward Primer: CTS194_F TTTGGTTGGGAAAAACATTTG
Reverse Primer: CTS194_R AATGCAGGCACAGTTGGAG
Reviews

Customers who bought this product also purchased
Z1231
Z1231
Z834
Z834
PF2287
PF2287
M267
M267
PF2272
PF2272
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies