Top » Catalog » SNPs » A816

$19.00

A816
[A816]

A816
hg38 Position: ChrY:19434612..19434612
Ancestral: C
Derived: A
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255 > Z16433 > FGC32914
Forward Primer: A816_F AAGTGAGGGTCACTCAGAAAGG
Reverse Primer: A816_R CCATGGATTTGATTCTGTTGC
Reviews

Customers who bought this product also purchased
A476
A476
A430
A430
Z16433
Z16433
R1b-Z255 Panel
R1b-Z255 Panel
A1247
A1247
A1154
A1154
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies