Top » Catalog » SNPs » FGC62036

$18.00

FGC62036
[FGC62036]

FGC62036
hg38 Position: ChrY:2854487..2854489
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62036_F CAGAGTTGCCCATTGAGGAC
Reverse Primer: FGC62036_R GATTCCCTTCACTCCCACAG
Reviews

Customers who bought this product also purchased
S782
S782
FGC5325
FGC5325
Wish a SNP
Wish a SNP
YFS071008
YFS071008
FGC45679
FGC45679
YFS071072
YFS071072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies