Top » Catalog » SNPs » S2361

$18.00

S2361
[S2361]

S2361
hg38 Position: ChrY:15243365..15243365
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a2a1
Comments: Below L801 > S2364, syn with Z167.
Forward Primer: S2361_F GAATGTGAATCAGCAGGTGAC
Reverse Primer: S2361_R ATATTGCCCAGGCTGTTGTG
Reviews

Customers who bought this product also purchased
M9
M9
CTS1977
CTS1977
Y6647
Y6647
HVR2
HVR2
L801
L801
L1317
L1317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies