Top » Catalog » SNPs » MZ89

$18.00

MZ89
[MZ89]

MZ89
hg38 Position: ChrY:7386529..7386529
Ancestral: C
Derived: A
Reference: unknown
ISOGG Haplogroup: E1b1b1b1af1a~
Comments: Downstream : A2227
Forward Primer: MZ89_F CCCCATATTCATGTGGATAATAAG
Reverse Primer: MZ89_R GGCAAGTGCCAACACATATCAC
Reviews

Customers who bought this product also purchased
Y182526
Y182526
MZ17
MZ17
PF2581
PF2581
MZ99
MZ99
PF2548
PF2548
MZ149
MZ149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies