Top » Catalog » SNPs » Y30121

$18.00

Y30121
[Y30121]

Y30121
hg38 Position: ChrY:20697966..20697966
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: N1a2b2a1* (not listed)
Comments: Below FGC38830.
Forward Primer: Y30121_F AACCTGCTCACACCTCCATC
Reverse Primer: Y30121_R AAAGTTGAGAGCCCGGGTAG
Reviews

Customers who bought this product also purchased
FGC10872
FGC10872
S18605
S18605
M232
M232
F2930
F2930
FGC38830
FGC38830
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x WGS400
$399.00
Haplogroup Info
Other products
Currencies