Top » Catalog » SNPs » FGC35955

$18.00

FGC35955
[FGC35955]

FGC35955
hg38 Position: ChrY:8882191..8882191
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I1a1 (unlisted)
Comments: Below DF29 > Y17611
Forward Primer: FGC35955_F AGTTTTAATATTGTCTTACCTTTCGATG
Reverse Primer: FGC35955_R ATCTCAGTAACTGATGTAACTATCAGGAAAG
Reviews

Customers who bought this product also purchased
A7627
A7627
S7660
S7660
FGC22115
FGC22115
FGC22112
FGC22112
A7626
A7626
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies