Top » Catalog » SNPs » FGC35958

$18.00

FGC35958
[FGC35958]

FGC35958
hg38 Position: ChrY:15297650..15297650
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I1a
Comments: Below DF29 > Y17611
Forward Primer: FGC35958_F GCACCCCTGCAACAGTAAG
Reverse Primer: FGC35958_R TGGGGGCTTGTAGGACATAG
Reviews

Customers who bought this product also purchased
FGC43220
FGC43220
FGC14515
FGC14515
FGC17110
FGC17110
A7627
A7627
FGC22115
FGC22115
S7660
S7660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies