Top » Catalog » SNPs » A17886

$18.00

A17886
[A17886]

A17886
hg38 Position: ChrY:12877398..12877398
Ancestral: C
Derived: T
Reference: Oleg Sukhanov (2017)
ISOGG Haplogroup: N
Comments: Below Y28536
Forward Primer: A17886_F GCGCTAATAAAACCACAATAATATACCA
Reverse Primer: A17886_R CTTCTGACATGGCCACTTGG
Reviews

Customers who bought this product also purchased
CTS10760
CTS10760
Y28526
Y28526
N1c-CTS10760 Panel
N1c-CTS10760 Panel
F4134
F4134
Y32731
Y32731
Y28536
Y28536
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies