Top » Catalog » SNPs » Y20020

$18.00

Y20020
[Y20020]

Y20020
HG19 Position: ChrY:17637559..17637559
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R2a2b1b2b2a1a
Comments: Below Y1331.
Forward Primer: Y20020_F TTGCAGGCATAAGCTACTGG
Reverse Primer: Y20020_R TCATGGCACTGCAGTCTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies