Top » Catalog » SNPs » Y33761

$18.00

Y33761
[Y33761]

Y33761
HG19 Position: ChrY:7010673..7010673
Ancestral: T
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Downstream from L233 > Y4252
Forward Primer: Y33761_F CAAAATGAAGCCAGAACTTGG
Reverse Primer: Y33761_R GATTACAGGCACCCACCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies