Top » Catalog » SNPs » M174

$18.00

M174
[M174]

M174
hg38 Position: ChrY:12842354..12842354
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: D
Comments: DffryEx38
Forward Primer: M174_F ACATCTCAGATCGTTGTTTGGT
Reverse Primer: M174_R AAAAAGCCATGCAATTACCTG
Reviews

Customers who bought this product also purchased
D-M174 Panel
D-M174 Panel
Z42600
Z42600
Z34364
Z34364
Z34359
Z34359
CTS1828
CTS1828
M533
M533
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies