Top » Catalog » SNPs » FGC37187

$18.00

FGC37187
[FGC37187]

FGC37187
HG19 Position: ChrY:21506881..21506881
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1c~
Comments: Below V22 > L674 > Y16563
Forward Primer: FGC37187_F TAGTCCTGGCTGGGTAGTGG
Reverse Primer: FGC37187_R CACCACTTGTGACCTTTTGG
Reviews

Customers who bought this product also purchased
M215
M215
Y16563
Y16563
P177
P177
V22
V22
FGC37180
FGC37180
E Superclade Panel
E Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
1 x HVR2
1 x mtComplete
1 x HVR1
$247.00
Haplogroup Info
Other products
Currencies