Top » Catalog » SNPs » FGC37187

$18.00

FGC37187
[FGC37187]

FGC37187
hg38 Position: ChrY:19344995..19344995
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1c~
Comments: Below V22 > L674 > Y16563
Forward Primer: FGC37187_F TAGTCCTGGCTGGGTAGTGG
Reverse Primer: FGC37187_R CACCACTTGTGACCTTTTGG
Reviews

Customers who bought this product also purchased
P177
P177
V22
V22
FGC37180
FGC37180
E Superclade Panel
E Superclade Panel
V13
V13
BY6712
BY6712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies