Top » Catalog » SNPs » FGC37187

$18.00

FGC37187
[FGC37187]

FGC37187
HG19 Position: ChrY:21506881..21506881
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1c~
Comments: Below V22 > L674 > Y16563
Forward Primer: FGC37187_F TAGTCCTGGCTGGGTAGTGG
Reverse Primer: FGC37187_R CACCACTTGTGACCTTTTGG
Reviews

Customers who bought this product also purchased
BY6697
BY6697
M78
M78
Y16536
Y16536
M215
M215
Y16563
Y16563
P177
P177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtComplete
1 x HVR2
1 x HVR1
$229.00
Haplogroup Info
Other products
Currencies