Top » Catalog » SNPs » BY246

$19.00

BY246
[BY246]

BY246
hg38 Position: ChrY:6969316..6969316
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Found in a person of the McWho cluster
Forward Primer: BY246_F CGAAAAAGGAAGCAACTGTG
Reverse Primer: BY246_R ATGGTCACCCACCATTTTTC
Reviews

Customers who bought this product also purchased
BY39002
BY39002
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY31279
BY31279
L513
L513
MC14
MC14
U152
U152
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies