Top » Catalog » SNPs » A883

$19.00

A883
[A883]

A883
hg38 Position: ChrY:17084316..17084316
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A883_F AAGAGCAGCACACGCTTTC
Reverse Primer: A883_R CAGAAAGTGAGCTGCACAGG
Reviews

Customers who bought this product also purchased
FGC55181
FGC55181
FGC5939
FGC5939
BY35731
BY35731
FT76199
FT76199
A18726
A18726
BY21239
BY21239
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies