Top » Catalog » SNPs » A18934

$18.00

A18934
[A18934]

A18934
hg38 Position: ChrY:18672471..18672471
Ancestral: T
Derived: C
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006
Forward Primer: A18934_F CCTTTGTCTCCGCTGAACTC
Reverse Primer: A18934_R TGTTGGAAGGGGAAAATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies