Top » Catalog » SNPs » A18898

$18.00

A18898
[A18898]

A18898
hg38 Position: ChrY:14308539..14308539
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: Below PF4074
Forward Primer: A18898_F GGTTGAAACACCCACCAGAG
Reverse Primer: A18898_R CAAAGGTCAGCCAATAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies