Top » Catalog » SNPs » A100

$18.00

A100
[A100]

A100
HG19 Position: ChrY:14032743..14032743
Ancestral: A
Derived: T
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1 (not listed)
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A100_F TAGCTAGTCTGATTGGAATAAGAAGATATGTA
Reverse Primer: A100_R GGCAGGTTTTTCATTACTGCC
Reviews

Customers who bought this product also purchased
A1000
A1000
A16874
A16874
A16873
A16873
A16867
A16867
A875
A875
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies