Top » Catalog » SNPs » A19274

$18.00

A19274
[A19274]

A19274
hg38 Position: ChrY:16679282..16679282
Ancestral: A
Derived: G
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19274_F GGCAATCAGCCATTTGATTC
Reverse Primer: A19274_R AATTGAAGGTGCCGAGAGTC
Reviews

Customers who bought this product also purchased
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19272
A19272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4634
$18.00
Haplogroup Info
Other products
Currencies