Top » Catalog » SNPs » A19278

$18.00

A19278
[A19278]

A19278
hg38 Position: ChrY:21200555..21200555
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19278_F TTTCACAATATTGATTCTTCCTATCTGTAAG
Reverse Primer: A19278_R AAAGCTCTCAGTAAACTGGGCC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19272
A19272
HU406
HU406
A19279
A19279
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies