Top » Catalog » SNPs » A19125

$18.00

A19125
[A19125]

A19125
hg38 Position: ChrY:15514725..15514725
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19125_F ACCCCACAATAGGATTTAGTTAACCTC
Reverse Primer: A19125_R GAAAGTTACCCAAAGCTTGCATC
Reviews

Customers who bought this product also purchased
A19138
A19138
A19154
A19154
R1a-YP1017 Brtnik Panel
R1a-YP1017 Brtnik Panel
A19133
A19133
A19145
A19145
A19120
A19120
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies