Top » Catalog » SNPs » A19142

$18.00

A19142
[A19142]

A19142
hg38 Position: ChrY:19296828..19296828
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19142_F ATCCTGAGACCCTGTGGTTG
Reverse Primer: A19142_R TTGTTCTGCAATGCAATCATC
Reviews

Customers who bought this product also purchased
A19077
A19077
A19152
A19152
FGC21108
FGC21108
A19088
A19088
A19314
A19314
FGC21114
FGC21114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies