Top » Catalog » SNPs » A19142

$18.00

A19142
[A19142]

A19142
hg38 Position: ChrY:19296828..19296828
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19142_F ATCCTGAGACCCTGTGGTTG
Reverse Primer: A19142_R TTGTTCTGCAATGCAATCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2864
1 x A255
1 x A2014
$54.00
Haplogroup Info
Other products
Currencies