Top » Catalog » SNPs » A19142

$18.00

A19142
[A19142]

A19142
hg38 Position: ChrY:19296828..19296828
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19142_F ATCCTGAGACCCTGTGGTTG
Reverse Primer: A19142_R TTGTTCTGCAATGCAATCATC
Reviews

Customers who bought this product also purchased
A19084
A19084
A19156
A19156
FGC21112
FGC21112
A19102
A19102
A19317
A19317
A19119
A19119
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies