Top » Catalog » SNPs » A19152

$18.00

A19152
[A19152]

A19152
hg38 Position: ChrY:20900311..20900311
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19152_F CTACTTTGTGGCCTCTCCTTTG
Reverse Primer: A19152_R CCTTCATTCTATTGAAGAGTACAGAATG
Reviews

Customers who bought this product also purchased
A19093
A19093
A19315
A19315
PF2606
PF2606
A19112
A19112
FGC21103
FGC21103
A19077
A19077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies