Top » Catalog » SNPs » A19152

$18.00

A19152
[A19152]

A19152
hg38 Position: ChrY:20900311..20900311
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19152_F CTACTTTGTGGCCTCTCCTTTG
Reverse Primer: A19152_R CCTTCATTCTATTGAAGAGTACAGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies