Top » Catalog » SNPs » FGC2585

$19.00

FGC2585
[FGC2585]

FGC2585
hg38 Position: ChrY:15322184..15322184
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2585_F GGAACTACCTGCCAGACATGG
Reverse Primer: FGC2585_R CACTGGAAGTAATGGCAGGG
Reviews

Customers who bought this product also purchased
FGC2590
FGC2590
FGC2573
FGC2573
FGC2589
FGC2589
FGC2571
FGC2571
FGC2582
FGC2582
R1a-FGC2555 Hollister Panel
R1a-FGC2555 Hollister Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies