Top » Catalog » SNPs » FGC2585

$18.00

FGC2585
[FGC2585]

FGC2585
hg38 Position: ChrY:15322184..15322184
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2585_F GGAACTACCTGCCAGACATGG
Reverse Primer: FGC2585_R CACTGGAAGTAATGGCAGGG
Reviews

Customers who bought this product also purchased
FGC2591
FGC2591
FGC2574
FGC2574
FGC2590
FGC2590
FGC2573
FGC2573
FGC2589
FGC2589
FGC2571
FGC2571
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies