Top » Catalog » SNPs » A19385

$19.00

A19385
[A19385]

A19385
hg38 Position: ChrY:15683131..15683131
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233
Forward Primer: A19385_F TAAAAGGGACCCCAGAGAGG
Reverse Primer: A19385_R GGAGATGGGGGTATGGTTTC
Reviews

Customers who bought this product also purchased
M253
M253
Y33765
Y33765
BY117344
BY117344
P38
P38
PF4294
PF4294
Y85503
Y85503
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies