Top » Catalog » SNPs » A19486

$18.00

A19486
[A19486]

A19486
hg38 Position: ChrY:15861622..15861622
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233
Forward Primer: A19486_F GCTCAAGCAATCCTTTCACC
Reverse Primer: A19486_R TAGCAATCACAGCACTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies