Top » Catalog » SNPs » FGC71318

$18.00

FGC71318
[FGC71318]

FGC71318
hg38 Position: ChrY:16611291..16611291
Ancestral: G
Derived: A
Reference: Michael Lally (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC71318_F TGGGAATCCAAGATGAACAAG
Reverse Primer: FGC71318_R TCACCCATCCTCTGTGTGAC
Reviews

Customers who bought this product also purchased
FGC71319
FGC71319
FGC71320
FGC71320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies