Top » Catalog » SNPs » FGC71319

$18.00

FGC71319
[FGC71319]

FGC71319
hg38 Position: ChrY:18886746..18886746
Ancestral: G
Derived: A
Reference: Michael Lally (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC71319_F AACAAAAGTCGACAACTGGAATC
Reverse Primer: FGC71319_R ACTGCTTTCCACCGTCATTG
Reviews

Customers who bought this product also purchased
FGC71318
FGC71318
FGC71320
FGC71320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies