Top » Catalog » SNPs » FGC71320

$18.00

FGC71320
[FGC71320]

FGC71320
hg38 Position: ChrY:21197083..21197083
Ancestral: T
Derived: G
Reference: Michael Lally (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC71320_F GTTAATGGGTGCAGGAAACC
Reverse Primer: FGC71320_R GACTTACAGTCTCACATGGTCAGG
Reviews

Customers who bought this product also purchased
FGC71319
FGC71319
FGC71318
FGC71318
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies