Top » Catalog » SNPs » Z17801

$19.00

Z17801
[Z17801]

Z17801
hg38 Position: ChrY:8624317..8624317
Ancestral: T
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17801_F CACCAAATGGGAGTGGAAAG
Reverse Primer: Z17801_R GGTAGAGATTCAGACAGCTTGCTG
Reviews

Customers who bought this product also purchased
Z16387
Z16387
Z16396
Z16396
Z17809
Z17809
FGC11788
FGC11788
Z16395
Z16395
Z17808
Z17808
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies