Top » Catalog » SNPs » FGC21227

$18.00

FGC21227
[FGC21227]

FGC21227
hg38 Position: ChrY:14979904..14979904
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21227v2_F AATGCCAGAGCTCTACCTGC
Reverse Primer: FGC21227v2_R GAATTACAAGATGGCCCACC
Reviews

Customers who bought this product also purchased
FGC21217
FGC21217
FGC21226
FGC21226
A19103
A19103
FGC21240
FGC21240
FGC21216
FGC21216
FGC21224
FGC21224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies