Top » Catalog » SNPs » A20298

$18.00

A20298
[A20298]

A20298
hg38 Position: ChrY:12201498..12201498
Ancestral: C
Derived: T
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20298_F GGAACCCCTATTCCCTTCTTC
Reverse Primer: A20298_R TGGCAGAATCATCACTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies