Top » Catalog » SNPs » A20301

$18.00

A20301
[A20301]

A20301
hg38 Position: ChrY:19950444..19950444
Ancestral: A
Derived: G
Reference: Walter Little (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20301_F CCCATTGGCTGCATATAATTAAG
Reverse Primer: A20301_R AAGCAAAAACAGAAAACCCAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies