Top » Catalog » SNPs » A20303

$18.00

A20303
[A20303]

A20303
hg38 Position: ChrY:20540855..20540855
Ancestral: C
Derived: T
Reference: Had Amli (2018)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: A20303_F CTTACCAACTGCAGGAAGGG
Reverse Primer: A20303_R TCCTGAAATGGAAAAGAAAGTTTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies