Top » Catalog » SNPs » A20305

$18.00

A20305
[A20305]

A20305
hg38 Position: ChrY:12558949..12558949
Ancestral: T
Derived: G
Reference: 2018
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20305_F TTTGGATTTTCTCTCGTCTTTTC
Reverse Primer: A20305_R AATGCCTGTTTGGTGGTTTC
Reviews

Customers who bought this product also purchased
A20304
A20304
Y133692
Y133692
A20307
A20307
A20306
A20306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies