Top » Catalog » SNPs » A20305

$18.00

A20305
[A20305]

A20305
hg38 Position: ChrY:12558949..12558949
Ancestral: T
Derived: G
Reference: 2018
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20305_F TTTGGATTTTCTCTCGTCTTTTC
Reverse Primer: A20305_R AATGCCTGTTTGGTGGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x J2a-M67 Panel
1 x A8549
$106.00
Haplogroup Info
Other products
Currencies