Top » Catalog » SNPs » Y78560

$18.00

Y78560
[Y78560]

Y78560
hg38 Position: ChrY:20567875..20567875
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS10710
Forward Primer: Y78560_F TTCAATGAGGCCACAATTACC
Reverse Primer: Y78560_R TGGATTTATCATGCAGGTTTC
Reviews

Customers who bought this product also purchased
YFS1655160
YFS1655160
J1-ZS10710 Panel
J1-ZS10710 Panel
Y76017
Y76017
Y66688
Y66688
Y69004
Y69004
ZS10716
ZS10716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies