Top » Catalog » SNPs » ZS10712

$18.00

ZS10712
[ZS10712]

ZS10712
hg38 Position: ChrY:13478552..13478552
Ancestral: C
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10712_F AATGCTGCTGTCAATGTTGG
Reverse Primer: ZS10712_R TACAGCGGTGAAGAGTTTGC
Reviews

Customers who bought this product also purchased
FGC4422
FGC4422
FT207523
FT207523
FGC34373
FGC34373
FGC5
FGC5
FGC1707
FGC1707
BY8
BY8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies