Top » Catalog » SNPs » A20039

$18.00

A20039
[A20039]

A20039
hg38 Position: ChrY:17334373..17334373
Ancestral: T
Derived: C
Reference: Armando Framarini (2018)
ISOGG Haplogroup: I1
Comments: Downstream S12289
Forward Primer: A20039_F CCCATACCTAATGCTTCTGTTG
Reverse Primer: A20039_R TGCAAGCAGACTCTCAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies