Top » Catalog » SNPs » A20064

$18.00

A20064
[A20064]

A20064
hg38 Position: ChrY:15453033..15453033
Ancestral: A
Derived: G
Reference: William Hartley (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z2535 YSC261 L338 S12289
Forward Primer: A20064_F TCCGCTTTTCTCCTTTTCTG
Reverse Primer: A20064_R TCGATGTAGCACCAATACTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies