Top » Catalog » SNPs » A20453

$18.00

A20453
[A20453]

A20453
hg38 Position: ChrY:16837622..16837622
Ancestral: A
Derived: G
Reference: William Hartley (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z2535/S1953+ YSC261 L338+ S12289+ A20033+
Forward Primer: A20453_F CAGCTTATTCTCCCCCATTC
Reverse Primer: A20453_R GTGGGAAGAAGCAGTGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies